DNA Mutation Simulation

DNA Mutation Simulation – Access the simulation at: ?https://www.biologycorner.com/worksheets/DNA-sim.html 1) Transcribe and Translate your original DNA. Review those terms and write a short definition Transcription: Translation: 2) Identify the major players shown in the simulation: mRNA, Codon, Amino Acid, tRNA, anticodon, ribosome. Use the figure below to label these parts.3. When the protein is completed, write the sequence of amino acids shown, there are 11. (Hint: click the “stop” button to make the model stop jiggling.) 4. Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG 5. Edit the DNA by changing all of the first triplet to AAA Check the new protein created by your new DNA. Describe how this changed the protein..biologycorner.comhttps://www.biologycorner.com/worksheets/DNA-sim.htmlhttp://www.biologycorner.com/6. Return the triplet to its original state (ATG). Now place an additional A after the G, your strand will read ATGA. ?Check the new protein created by your new DNA. Describe how this changed the protein. 7. Return the triplet to its original state (ATG). Now change the second triplet from CCA to CCC. Check the new protein created by your new DNA. Describe how this changed the protein. Final Analysis – There are three mutations you explored in this activity. You can use what you observed in the activity to help you answer the questions or search other sources if you are still confused. 8. First, you created a ?POINT? mutation in your DNA. Describe what a point mutation is an how this can affect the protein created by the gene. 9. The second mutation you explored is called a ?FRAMESHIFT? mutation. Explain what this means and how it affects the protein. 10. The third mutation you explored is a special kind of point mutation called a ?SILENT? mutation. Explain what this means.www.biologycorner.comhttp://www.biologycorner.com/

So much stress and so little time? Take care of yourself: let us help you with your task on
DNA Mutation Simulation
Get a 20% Discount on this Paper
Get Help Now
Calculate the price
Make an order in advance and get the best price
Pages (550 words)
$0.00
*Price with a welcome 15% discount applied.
Pro tip: If you want to save more money and pay the lowest price, you need to set a more extended deadline.
We know how difficult it is to be a student these days. That's why our prices are one of the most affordable on the market, and there are no hidden fees.

Instead, we offer bonuses, discounts, and free services to make your experience outstanding.
Sign up, place your order, and leave the rest to our professional paper writers in less than 2 minutes.
step 1
Upload assignment instructions
Fill out the order form and provide paper details. You can even attach screenshots or add additional instructions later. If something is not clear or missing, the writer will contact you for clarification.
s
Get personalized services with Do My Homeworkk
One writer for all your papers
You can select one writer for all your papers. This option enhances the consistency in the quality of your assignments. Select your preferred writer from the list of writers who have handledf your previous assignments
Same paper from different writers
Are you ordering the same assignment for a friend? You can get the same paper from different writers. The goal is to produce 100% unique and original papers
Copy of sources used
Our homework writers will provide you with copies of sources used on your request. Just add the option when plaing your order
What our partners say about us
Check out the latest reviews and opinions submitted by real customers worldwide and make an informed decision.
Finance
Thank you
Customer 452445, September 8th, 2021
Nursing
Excellent! Followed directions and completed a great paper
Customer 452445, August 22nd, 2021
National Security Intelligence and Security Analysis
Timeliness
Customer 452457, November 3rd, 2021
Nursing
Good work, professional and beat the deadline. Thank you so very much
Customer 452445, August 24th, 2021
Business Studies
I can't even explain how much your help meant to me. Thnk you always
Customer 452443, November 15th, 2021
English 101
Great work!
Customer 452443, December 2nd, 2021
Leadership Studies
This is great! Thanks a bunch
Customer 452485, March 1st, 2022
Philosophy
The paper was done to my satisfaction. Thnk you.
Customer 452443, November 18th, 2021
Chemistry
Excellent services!
Customer 452443, November 11th, 2021
Chemical Engineering
Amazing. The writer delivered the draft earlier than expected, lol. I am pleased with the work; I hope my supervisor will like it too.
Customer 452443, September 1st, 2021
Finance
Excellent. Thnk you
Customer 452443, October 22nd, 2021
Finance
Wow! I should never have doubted you guys. Thank you for the excellent grade
Customer 452443, August 27th, 2021
OUR GIFT TO YOU
15% OFF your first order
Use a coupon FIRST15 and enjoy expert help with any task at the most affordable price.
Claim my 15% OFF Order in Chat

Order your essay today and save 15% with the discount code ESSAYHELP